SubtiWiki SubtiWiki
purK
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

purK
168

phosphoribosylaminoimidazole carboxylase (ATP-dependent)

locus
BSU_06430
Molecular weight
42.00 kDa
pI
5.12
Protein length
Gene length
function
purine biosynthesis
product
phosphoribosylaminoimidazole carboxylase (ATP-dependent)
essential
no
ec
4.1.1.21
synonyms
purK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0026

This gene is a member of the following regulons

Gene
Coordinates
699,093  700,235
The protein
Catalyzed reaction/ biological activity
5-amino-1-(5-phospho-β-D-ribosyl)imidazole + ATP + hydrogencarbonate --> 5-carboxyamino-1-(5-phospho-D-ribosyl)imidazole + ADP + 2 H+ + phosphate(according to UniProt)
Protein family
PurK/PurT family (with [protein|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT], according to UniProt)
[wiki|Domains]
[wiki|ATP-grasp doamin] (aa 112-298) (according to UniProt)
Structure
[PDB|2Z04] (from ''Aquifex aeolicus'', 37% identity, 57% similarity)
Paralogous protein(s)
[protein|C00E34EF63B5EAE33CAD5E469893C0A5112B9F35|purT]
Expression and Regulation
Operons
genes
[gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
description
[Pubmed|3036807]
regulation
expression activated by glucose (4.4 fold) [Pubmed|12850135]
regulatory mechanism
G-box: termination, ([wiki|riboswitch]) [pubmed|3036807,12787499], in [regulon|other_regulator:G-box|G-box]
[protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|protein:A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3036807], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]→[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]

2021-09-15 10:29:43

Jstuelk

12

ace69dc80f4f087486c218727fa370a7a9630d21

EDD8EC37B0E5B38941D5827C265AB2F23CF23EA7

Biological materials
Mutant
BKE06430 ([gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TACAGCTCCCGGATAGATGA,  downstream forward: _UP4_AATAGAGACGGAGGACAAGC
BKK06430 ([gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06430 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TACAGCTCCCGGATAGATGA,  downstream forward: _UP4_AATAGAGACGGAGGACAAGC
References
3036807,12923093,7638212

0DA73E4D1935F6A91BE251EF2704A11DE5D81174

Page visits: 1723

Time of last update: 2021-09-12 04:10:51

Author of last update: Melvin.boenninger