SubtiWiki SubtiWiki
dhbC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

dhbC
168

isochorismate synthase

locus
BSU_31990
Molecular weight
43.29 kDa
pI
5.17
Protein length
Gene length
function
biosynthesis of the siderophore bacillibactin
product
isochorismate synthase
essential
no
ec
5.4.4.2
synonyms
dhbC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1169

This gene is a member of the following regulons

Gene
Coordinates
3,290,289  3,291,485
Phenotypes of a mutant
defective in biofilm formation, this can be suppressed by the addition of 2,3-dihydroxybenzoate to the medium [pubmed|31420537]
The protein
Catalyzed reaction/ biological activity
Chorismate --> isochorismate (according to UniProt)
Protein family
isochorismate synthase family (with [protein|8EFE4D2B07E54A0EE7D6821C9FEBFC7DC22FDE03|menF], according to UniProt)
Structure
[PDB|3OS6], (from ''B. anthracis'', 56% identity, 70% similarity)
Modification
phosphorylation on Ser-271 [Pubmed|17218307]
Expression and Regulation
Operons
genes
[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]-[gene|DD647083C2E6968AD26A41C9F4EFBA942D75207C|ybdZ]
description
[Pubmed|8921902]
regulation
induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre]: repression, in [regulon|protein:65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8550523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI]: sigma factor, [pubmed|29914988], in [regulon|protein:3DEAC421B4B173C6BBC700E57790751B7AFDF319|sigI regulon]
additional information
the ''[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]-[gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]-[gene|B864EC6D21AD5E524AC13AE1BE41F5CD7FC399C5|dhbE]-[gene|1346D57F906EE5BD36F7FBFA1E4884EEBC8585FA|dhbB]-[gene|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|dhbF]'' operon is strongly unregulated in a ''[wiki|kre]'' mutant [Pubmed|26110430]
Open in new tab

[gene|42C8D303AABFA2A9706295A0F90B0B49F854B0BF|dhbA]→[gene|DD647083C2E6968AD26A41C9F4EFBA942D75207C|ybdZ]

2021-09-17 03:45:57

Jstuelk

6

875cbc1c026244834e2efbc1140499985c0ab89d

CCA159D50C58E2078C51F543EDA686D77F6612EE

Biological materials
Mutant
BKE31990 ([gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCATGAACCTCCTTT,  downstream forward: _UP4_TGAACAGAATGAATTGCTGG
BKK31990 ([gene|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|dhbC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCATGAACCTCCTTT,  downstream forward: _UP4_TGAACAGAATGAATTGCTGG
References
8224884,11112781,11790741,12354229,17218307,8921902,8550523,20817675,21815947,26110430,29133393,29914988,31420537

0D4D200095AD4F9B30179B9AF500306EDA61F5D1

Page visits: 1857

Time of last update: 2021-09-18 22:14:41

Author of last update: Jstuelk