SubtiWiki SubtiWiki
ylqG
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylqG
168

unknown

locus
BSU_16070
Molecular weight
62.86 kDa
pI
7.05
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ylqG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,678,250  1,679,980
Expression and Regulation
Operons
genes
[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]-[gene|0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2|ylqG]-[gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]
description
[Pubmed|26577401]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|26577401], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Open in new tab

[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]→[gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]

2020-11-06 12:56:32

ghost

0

98f7ebb4fcf1623da9e58287f3624156459fba8c

1CC90F1BF46AECEE0BD7591672B817F5E16299E6

genes
[gene|54CD247926F7FABE4ACE85EB7021B62500B47260|rbgA]-[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB]-[gene|0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2|ylqG]-[gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]
description
[Pubmed|22383849]
Open in new tab

[gene|54CD247926F7FABE4ACE85EB7021B62500B47260|rbgA]→[gene|3F271D9FFE4F30D845319CD71662695AA592EC8F|ylqH]

2021-09-16 10:00:30

Jstuelk

6

eeb1b6a4de31a5049ef87638911db24d52f44a7c

3D86AE4ED34D50165869C1951375B5B0E636471C

Biological materials
Mutant
MGNA-B142 (ylqG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1141 NBRP B. subtilis, Japan]
BKE16070 ([gene|0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2|ylqG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAAAGGTGCCTCC,  downstream forward: _UP4_GATCAGGAAGTGGATGTGAA
BKK16070 ([gene|0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2|ylqG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAAAGGTGCCTCC,  downstream forward: _UP4_GATCAGGAAGTGGATGTGAA
References
26577401

0D4A4A1B2FD9D0698D0A65010A8ABC84DA7386A2

Page visits: 677

Time of last update: 2021-09-07 20:57:56

Author of last update: Bzhu