SubtiWiki SubtiWiki
nahA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nahA
168

RNA pyrophosphohydrolase, converts primary transcripts to 5’-monophosphate RNA

locus
BSU_34780
Molecular weight
18.07 kDa
pI
4.99
Protein length
Gene length
function
initiation of RNA degradation
product
RNA pyrophosphohydrolase
essential
no
synonyms
nahA, yvcI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1051

This gene is a member of the following regulons

Gene
Coordinates
3,572,413  3,572,889
The protein
Catalyzed reaction/ biological activity
converts primary transcripts to 5’-monophospate RNA [pubmed|31740579]
prefers G-initiating  RNAs  and required at least one unpaired nucleotide at the 5’-end  of  its  substrates, with  the  5’-terminal nucleotide determining whether primarily ortho- or pyrophosphate is released [pubmed|31740579]
Protein family
[wiki|Nudix hydrolase] (according to UniProt)
[wiki|Domains]
[wiki|Nudix hydrolase domain] (aa 3-130) (according to UniProt)
[wiki|Cofactors]
Mn2+ [pubmed|31740579]
Structure
[PDB|3FK9] (the protein from ''B. halodurans'', 59% identity/ 82% similarity)
Expression and Regulation
Operons
genes
[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]-[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]-[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]-[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA]-[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]-[gene|C521BEE1EEEA7AD283A3C47C34301A8603CD9188|yvcN]
description
[Pubmed|9237995]
regulation
constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16272399], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
Open in new tab

[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]→[gene|C521BEE1EEEA7AD283A3C47C34301A8603CD9188|yvcN]

2021-09-16 23:41:26

ghost

12

bcc5699f6256b8a1b7fd8a979dbbbc9d4d1198ab

9244FB113E998572106D983A19AB3AC81B9F9D35

Biological materials
Mutant
MGNA-B642 (yvcI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1641 NBRP B. subtilis, Japan]
BKE34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC,  downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
BKK34780 (Δ[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|nahA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTAACCTTCGTCCTGTC,  downstream forward: _UP4_TAGAAAGACAAGTCAGGGGG
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
12850135,9237995,16272399,20525796,31740579

0C40455EB53D25363FC3EB0E84502A76520F5F91

Page visits: 3124

Time of last update: 2021-09-18 22:06:07

Author of last update: Jstuelk