SubtiWiki SubtiWiki
sspG
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sspG
168

small acid-soluble spore protein (minor)

locus
BSU_32640
Molecular weight
5.14 kDa
pI
4.25
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor)
essential
no
synonyms
sspG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,354,066  3,354,212
Expression and Regulation
Operons
genes
[gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]
description
[Pubmed|9852018]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,9852018]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|9852018], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,9852018], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]

2020-11-06 12:56:32

ghost

0

5c00740f25005274d58e39e7a0fa505b0f72d92f

25117306A126BFEEE0718C9A5FD1B21811F29CED

genes
[gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]-[gene|B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC|yurS]
description
[Pubmed|9852018]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,9852018]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|9852018], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,9852018], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]→[gene|B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC|yurS]

2021-07-14 21:07:15

ghost

1

0212569ab285de6f6fa6f328401107f1e018fc91

ADE853E2E644B92ADA3577E373D9E91BA5F9D399

Biological materials
Mutant
BKE32640 ([gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTATCATCCTTTCTCT,  downstream forward: _UP4_CAGTCACAAGACGGAGAAGA
BKK32640 ([gene|0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3|sspG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32640 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTATCATCCTTTCTCT,  downstream forward: _UP4_CAGTCACAAGACGGAGAAGA
References
9852018,15699190,12850135,27766092

0B97EA2CAE873DB4BC541FB87FC784C88B4DC5C3

Page visits: 1028

Time of last update: 2021-08-05 14:27:25

Author of last update: Bzhu