SubtiWiki SubtiWiki
tpi

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

tpi
168

triose phosphate isomerase, glycolytic/ gluconeogenic enzyme

locus
BSU_33920
Molecular weight
26.88 kDa
pI
4.79
Protein length
Gene length
function
enzyme in glycolysis/ gluconeogenesis
product
triosephosphate isomerase
essential
no
ec
5.3.1.1
synonyms
tpi, tpiA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0149

This gene is a member of the following regulons

Gene
Coordinates
3,479,405  3,480,166
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
poor growth [pubmed|28189581]
poorly transformable [pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
D-glyceraldehyde 3-phosphate --> dihydroxyacetone phosphate (according to UniProt)
Protein family
triosephosphate isomerase family (single member,according to UniProt)
Structure
[PDB|1BTM] (complex with 2-phosphoglycolic acid, Geobacillus stearothermophilus),  complex with 2-phosphpoglycolic acid, ''Geobacillus stearothermophilus'' [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=48255 NCBI]
Modification
phosphorylation on Ser-213 [Pubmed|17218307]
Effectors of protein activity
inhibited by 2-phosphoglycolate (in ''B. stearothermophilus'') [Pubmed|8580851]
[wiki|Localization]
cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009,16479537]
Additional information
extensive information on the structure and enzymatic properties of Tpi can be found at [http://www.proteopedia.org/wiki/index.php/Triose_Phosphate_Isomerase Proteopedia]
belongs to the 100 [http://subtiwiki.uni-goettingen.de/wiki//index.php/Most_abundant_proteins most abundant proteins] [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]-[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]-[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]-[gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]-[gene|C86FB523451AC172A20801829B717E5A5F914211|pgm]-[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]
description
[Pubmed|11489127]
regulation
expression induced by glycolytic intermediates ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]) [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] [Pubmed|11489127]
the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
regulatory mechanism
[protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]: repression, [Pubmed|11489127], in [regulon|protein:ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11489127], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]→[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]

2021-09-29 21:39:52

Jstuelk

11

7b5a04e0f51be88bb9a430514dd0cb9d39ea3a2c

24906FF9311EDEA4AFD94747BD67B2022E642FAB

genes
[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]-[gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]-[gene|C86FB523451AC172A20801829B717E5A5F914211|pgm]-[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]
description
[Pubmed|11489127]
Open in new tab

[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]→[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]

2021-10-16 15:34:42

Jstuelk

11

c718c56bfee7b3945ef7060e9c50614ecf6b1cd7

D821B77CDDBA7B2EDE01B5B3E2E0A964498A261D

Biological materials
Mutant
GP700 (cat), available in [wiki|Jörg Stülke]'s lab, [Pubmed|23420519]
BKK33920 ([gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTCCACTTCCTTAT,  downstream forward: _UP4_GTTCAATTATTGGAGGAAGG
Expression vectors
pGP394 (N-terminal His-tag, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP89 (N-terminal Strep-tag, for [wiki|SPINE], expression in B. subtilis), available in [wiki|Jörg Stülke]'s lab, [pubmed|19193632]
pGP1511 (expression in ''B. subtilis'', in [wiki|pBQ200]), available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab, [pubmed|19193632]
References
12850135,11489127,17505547,8021172,17218307,8580851,19193632,21821766,23420519,15378759,24825009,28189581

0B5E910DC94463E34ABD393E3A8F20191E4A38B2

Page visits: 1983

Time of last update: 2021-10-19 09:20:14

Author of last update: TPed