SubtiWiki SubtiWiki
ylqD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ylqD
168

unknown

locus
BSU_16010
Molecular weight
14.90 kDa
pI
8.13
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ylqD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,674,259  1,674,645
Expression and Regulation
Operons
genes
[gene|8F559BFC80FE56EA0389A2336F4E9E6908562BCB|ylxM]-[gene|EC025F78D0BCBD91162BAAB9EAB7D3837E0A3208|ffh]-[gene|25C4850812DC216C1BEFBF07DCA71CC6820930B0|rpsP]-[gene|67FB5F6FB0B2701BD8E4FDD8DF06B236DE6A2599|ylqC]-[gene|0AB1FB44E8F28944B82B5EF14A9CDCFEE46DB76B|ylqD]-[gene|34B0FA6E7E25D1E5D8A54B70F5562BD0BD05B498|rimM]-[gene|885ECD9FAAC8BC95D32F049825D6B6244C046112|trmD]-[gene|51368512B8322EDBCA92674EC2B97CF26087D8A9|rplS]
description
[Pubmed|29794222]
regulation
the mRNA is processed between [gene|EC025F78D0BCBD91162BAAB9EAB7D3837E0A3208|ffh] and [gene|25C4850812DC216C1BEFBF07DCA71CC6820930B0|rpsP] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ylbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT] complex [Pubmed|29794222]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8335643], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8F559BFC80FE56EA0389A2336F4E9E6908562BCB|ylxM]→[gene|51368512B8322EDBCA92674EC2B97CF26087D8A9|rplS]

2021-09-21 18:28:02

Jstuelk

17

4f2ff9a3b937ee85312d0b0f9da494e4b44e2297

417C7007C2492335257F8AEF606BB8627753757F

Biological materials
Mutant
MGNA-B174 (ylqD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1173 NBRP B. subtilis, Japan]
BKE16010 ([gene|0AB1FB44E8F28944B82B5EF14A9CDCFEE46DB76B|ylqD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGCACCAAGCTCCCCGC,  downstream forward: _UP4_ATTGAAATTCGCCAGAGGTG
BKK16010 ([gene|0AB1FB44E8F28944B82B5EF14A9CDCFEE46DB76B|ylqD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGCACCAAGCTCCCCGC,  downstream forward: _UP4_ATTGAAATTCGCCAGAGGTG

0AB1FB44E8F28944B82B5EF14A9CDCFEE46DB76B

Page visits: 707

Time of last update: 2021-10-15 03:35:21

Author of last update: Bzhu