SubtiWiki SubtiWiki
yqjQ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqjQ
168

similar to ketoacyl reductase

locus
BSU_23780
Molecular weight
28.19 kDa
pI
9.16
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yqjQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0300

This gene is a member of the following regulons

Gene
Coordinates
2,471,002  2,471,781
The protein
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|3RKU] (from Saccharomyces Cerevisiae 36% identity)
Paralogous protein(s)
[protein|18698DA427051097DEEE63F45F3429B8617B1F48|yxnA], (32,1%)
Expression and Regulation
Operons
genes
[gene|35B40D812B123766B469B8E5C0FE0EB69F671E4E|yqjP]-[gene|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ]-[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]-[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]-[gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]
description
[pubmed|22383849]
Open in new tab

[gene|35B40D812B123766B469B8E5C0FE0EB69F671E4E|yqjP]→[gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]

2021-09-18 20:38:57

Jstuelk

11

849135de1757b2b3b5c94019b4a82218149cb07b

7866C7C07985979A54369C1D59D36565C48D9B56

Biological materials
Mutant
MGNA-C397 (yqjQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2395 NBRP B. subtilis, Japan]
BKE23780 ([gene|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCCGCTATATGTTTCACCC,  downstream forward: _UP4_TAATGATAGAACTGCCTGTG
BKK23780 ([gene|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCCCGCTATATGTTTCACCC,  downstream forward: _UP4_TAATGATAGAACTGCCTGTG

0927C7D45721F47F5ED2646CAAC324A308FD7724

Page visits: 811

Time of last update: 2021-09-03 10:39:58

Author of last update: Jstuelk