SubtiWiki SubtiWiki
iolB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

iolB
168

formation of 2-deoxy-5-keto-gluconic acid (4th reaction)

locus
BSU_39750
Molecular weight
30.62 kDa
pI
4.77
Protein length
Gene length
function
myo-inositol catabolism
product
formation of 2-deoxy-5-keto-gluconic acid (4th reaction)
essential
no
ec
null
synonyms
iolB, yxdB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3718

This gene is a member of the following regulons

Gene
Coordinates
4,082,030  4,082,845
The protein
Catalyzed reaction/ biological activity
5-deoxy-D-glucuronate --> 5-dehydro-2-deoxy-D-gluconate (according to UniProt)
Protein family
isomerase IolB family (single member, according to UniProt)
Structure
[PDB|2QJV] (from ''Salmonella typhimurium'', 49% identity, 65% similarity)
Expression and Regulation
Operons
genes
[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
description
[Pubmed|9226270]
regulation
induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
regulatory mechanism
[protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]: repression, [Pubmed|9887260,9226270], in [regulon|protein:5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9226270], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]→[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]

2021-09-02 11:47:09

ghost

4

4fd092965338ef1511600132442d2247a2693c98

C19E63046F0B412961D2626F72E0308D922D50B2

Biological materials
Mutant
MGNA-B771 (iolB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1770 NBRP B. subtilis, Japan]
BKE39750 ([gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAGAAGCCCTCCTCTT,  downstream forward: _UP4_TAACAAGTGAGGAGTGGCTG
BKK39750 ([gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAGAAGCCCTCCTCTT,  downstream forward: _UP4_TAACAAGTGAGGAGTGGCTG
labs
[wiki|Yasutaro Fujita], University of Fukuyama, Japan
[[Ken-ichi Yoshida]], Kobe University, Japan
References
9226270,11566986,18310071,9887260,18310071

0903CCBE053230998A9123F3269868E952C0F76B

Page visits: 1480

Time of last update: 2021-09-15 10:27:32

Author of last update: Melvin.boenninger