SubtiWiki SubtiWiki
comK
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

comK
168

competence transcription factor (CTF)

locus
BSU_10420
Molecular weight
22.28 kDa
pI
7.67
Protein length
Gene length
function
regulation of [wiki|genetic competence] and DNA uptake
product
competence transcription factor (CTF)
essential
no
synonyms
comK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4903

This gene is a member of the following regulons

Gene
Coordinates
1,117,109  1,117,687
Phenotypes of a mutant
no expression of competence genes, loss of [wiki|genetic competence] [Pubmed|7783616]
The protein
Modification
phosphorylated on Arg-65, Arg-157, Arg-161, Arg-165, Arg-186, and Arg-191 [Pubmed|22517742]
Expression and Regulation
Operons
genes
[gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]
description
[Pubmed|8196543]
regulation
[gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] has a bistable expression pattern [Pubmed|26110430]
expression is reduced in a [gene|search|cwlO ]mutant [pubmed|29553055]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|11849533], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|8830686], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12586407], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, (autoregulation) [Pubmed|8083168], in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]-P, acts as antagonist of [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok] [Pubmed|22412392], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8196543], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]

2021-09-04 12:13:54

Jstuelk

8

ede3afd4a4c7036d3f5b85a0dd49b3e7ccd41026

045A60522A106592E4B638A80091FACA469ABACE

additional information
full expression of [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] requires fully assembled and rotating flagella [pubmed|28800172]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P represses comK expression [pubmed|28800172]
Biological materials
Mutant
1A871 (no resistance), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A871&Search=1A871 BGSC]
BKE10420 ([gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATGGCCTCCATCCT,  downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT
BKK10420 ([gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTATGGCCTCCATCCT,  downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT
Expression vectors
for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
labs
[wiki|Oscar Kuipers], University of Groningen, The Netherlands
[http://molgen.biol.rug.nl/molgen/index.php Homepage]
References
Reviews
19995980,12576575,26110607,31950915,34438398
Original Publications
8878039,11849533,17569828,9335269,17560370,12586407,11814663,9108277,9890793,9585513,15819619,10908654,9000055,7746142,8830686,10447896,12028382,8016067,10361283,11703662,12107147,17581123,8016066,17493123,16391071,16436435,12270822,15598897,20300532,12761164,12036071,21085679,22517742,7783616,22412392,8083168,24838881,8196543,26110430,27045827,27920766,28800172,29124898,29553055,34016970
The [wiki|ComK regulon]
11948146,11918817

08CFA2C72931A75532D4289BC1D18A826DE9F9CA

Page visits: 16111

Time of last update: 2021-09-15 16:52:24

Author of last update: Jstuelk