SubtiWiki SubtiWiki
xpaC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

xpaC
168

hydrolysis of 5-bromo-4-chloroindolyl phosphate

locus
BSU_00250
Molecular weight
23.81 kDa
pI
10.15
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
xpaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4915

This gene is a member of the following regulons

Gene
Coordinates
35,845  36,459
Expression and Regulation
Operons
genes
[gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
description
[Pubmed|22383849]
Open in new tab

[gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]→[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]

2021-09-18 05:56:16

Jstuelk

18

adcd0181c3bf7f5a66d1644d176d0c60f2121a3a

87CEB0D67D1455F48A42F665A0B9A91B779AEC5D

genes
[gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]
description
[Pubmed|22383849]
regulation
expressed in stationary phase
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|9987136], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|22383849], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]→[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]

2021-09-10 21:30:37

ghost

6

7abb07cd575ba41a995431f6ebc94468beb3ee78

DCAF5B7EFE6C076A4C00A688D242AC2F436F8CAC

Biological materials
Mutant
BKE00250 ([gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGATAATCGACTCCTG,  downstream forward: _UP4_AAATAAGGGAAGAGGGTAAG
BKK00250 ([gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGATAATCGACTCCTG,  downstream forward: _UP4_AAATAAGGGAAGAGGGTAAG
References
9987136,22383849

08314FA6195D553B8522BCD3B45FEE0EAB51F64D

Page visits: 1289

Time of last update: 2021-09-10 21:17:19

Author of last update: Bzhu