SubtiWiki SubtiWiki
ykrP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ykrP
168

putative membrane-bound acyltransferase

locus
BSU_13520
Molecular weight
39.25 kDa
pI
9.99
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykrP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3594

This gene is a member of the following regulons

Gene
Coordinates
1,417,938  1,418,960
The protein
Protein family
Acyltransferase 3 family (with [protein|A408883503931320B1BC04F38E6D475530518A25|yfiQ] and [protein|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA],according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|07A53089107037359C428549FF877638B90CF074|ykrP]
description
[pubmed|22383849]
Open in new tab

[gene|07A53089107037359C428549FF877638B90CF074|ykrP]

2021-10-05 23:02:04

Jstuelk

3

9538256d325e4d7ff937ad9e57521639fb593467

B9AD78463965D9A9788F8FCCCC6C023266B1BF10

Biological materials
Mutant
MGNA-B318 (ykrP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1317 NBRP B. subtilis, Japan]
BKE13520 ([gene|07A53089107037359C428549FF877638B90CF074|ykrP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCATCACCTTCTCTTT,  downstream forward: _UP4_TAGAAAAAGCACCTCTTAAG
BKK13520 ([gene|07A53089107037359C428549FF877638B90CF074|ykrP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCATCACCTTCTCTTT,  downstream forward: _UP4_TAGAAAAAGCACCTCTTAAG

07A53089107037359C428549FF877638B90CF074

Page visits: 855

Time of last update: 2021-10-15 13:13:34

Author of last update: Jstuelk