SubtiWiki SubtiWiki
csgA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

csgA
168

required for the ability of the germinating spore to resume vegetative growth

locus
BSU_02070
Molecular weight
9.70 kDa
pI
4.69
Protein length
Gene length
function
spore germination
product
unknown
essential
no
ec
null
synonyms
csgA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5862

This gene is a member of the following regulons

Gene
Coordinates
228,066  228,314
Expression and Regulation
Operons
genes
[gene|07813844C05DB8670B810251979782094D184549|csgA]-[gene|5C81DD256BDEE777EE67566D3061131CFFAEAF21|ybxH]
description
[Pubmed|9016963]
regulation
expressed during sporulation in the forespore ([wiki|SpoVT]) [Pubmed|9016963]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,9016963], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|07813844C05DB8670B810251979782094D184549|csgA]→[gene|5C81DD256BDEE777EE67566D3061131CFFAEAF21|ybxH]

2021-08-24 06:23:57

ghost

2

b77e88be3141aa65cfab6b542dca87533d5e9383

A06F2DB99E1B2C47FDF3845D0DEE2F4A3812C681

Biological materials
Mutant
BKE02070 ([gene|07813844C05DB8670B810251979782094D184549|csgA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTATGAACACCTTTCC,  downstream forward: _UP4_CTGCTTTGAGAAAGGCGGGT
BKK02070 ([gene|07813844C05DB8670B810251979782094D184549|csgA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTATGAACACCTTTCC,  downstream forward: _UP4_CTGCTTTGAGAAAGGCGGGT
References
9016963,15699190

07813844C05DB8670B810251979782094D184549

Page visits: 997

Time of last update: 2021-08-16 22:28:37

Author of last update: Bzhu