SubtiWiki SubtiWiki
fadA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fadA
168

acetyl-CoA C-acyltransferase

locus
BSU_32830
Molecular weight
40.96 kDa
pI
5.18
Protein length
Gene length
function
fatty acid degradation
product
acetyl-CoA C-acyltransferase
essential
no
ec
2.3.1.16
synonyms
fadA, yusK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0183

This gene is a member of the following regulons

Gene
Coordinates
3,368,839  3,370,014
The protein
Catalyzed reaction/ biological activity
acetyl-CoA + acyl-CoA --> 3-oxoacyl-CoA + CoA (according to UniProt)
Protein family
[wiki|thiolase-like superfamily] (according to UniProt)
Structure
[PDB|3SS6] (the protein of ''B. anthracis'', 41% identity, 73% similarity)
Paralogous protein(s)
[protein|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA], [protein|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]
Expression and Regulation
Operons
genes
[gene|4787161A022E938A6D58A505D92369F889C7DE04|fadN]-[gene|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]-[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]
description
[Pubmed|17189250]
regulation
''[protein|search|fadN]'': induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
regulatory mechanism
[protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]: activation, [Pubmed|12817086], in [regulon|protein:29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR regulon]
[protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]: repression, [Pubmed|17189250], in [regulon|protein:8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|21398533], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17189250], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|4787161A022E938A6D58A505D92369F889C7DE04|fadN]→[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]

2021-09-06 05:32:15

ghost

9

5f1e349b432a9058e9ca7ab2008a19fa9609b3d3

64A593E7BDE4F4B739AFAF65983E90DDA2D2CE72

genes
[gene|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]-[gene|4787161A022E938A6D58A505D92369F889C7DE04|fadN]-[gene|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]-[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]
description
[Pubmed|17189250]
regulation
''[protein|search|fadM]'': induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
regulatory mechanism
[protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]: repression, [Pubmed|17189250], in [regulon|protein:8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR regulon]
[protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR]: activation, [Pubmed|12817086], in [regulon|protein:29A3EC8FB0C763A973273AA14EAEB904847C3002|sdpR regulon]
Open in new tab

[gene|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|fadM]→[gene|B5325CBF1408E2CA227EB462092E209F4C87E797|fadE]

2021-05-23 19:05:30

ghost

5

9bfdfb93c4077983c0e3142e433ac74ae81a5d62

8E61A92B7F4E3CA1E4373E8AFCCD07598481ACA4

Biological materials
Mutant
MGNA-A603 (yusK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/603 NBRP B. subtilis, Japan]
BKE32830 ([gene|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GACTGCCTCTTTCATAAGCT,  downstream forward: _UP4_TTATGCTAAAGGGGGAAAAA
BKK32830 ([gene|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GACTGCCTCTTTCATAAGCT,  downstream forward: _UP4_TTATGCTAAAGGGGGAAAAA
References
17189250,12817086,17919287

07498A0A3CB598A6E388540124A4F56E781C86FA

Page visits: 1528

Time of last update: 2021-09-13 21:46:40

Author of last update: Melvin.boenninger