SubtiWiki SubtiWiki
sdpB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sdpB
168

membrane protein, required for [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin maturation

locus
BSU_33760
Molecular weight
37.30 kDa
pI
9.52
Protein length
Gene length
function
maturation of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC] toxin
product
unknown
essential
no
synonyms
sdpB, yvaX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,464,762  3,465,733
The protein
Paralogous protein(s)
[protein|81E929FD7F66A996300C8412BE172883C262BD67|yitO]
[wiki|Localization]
cell membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]-[gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]-[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]
description
[Pubmed|12817086]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|14651647,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|15687200,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab

[gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]→[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]

2021-09-08 22:30:49

ghost

5

2fcaa28fd6df9e360eb7b7713a66bcca85a76c64

29EABA10B87FFC2DBA2CD17C1DA823E6512A5B7B

Biological materials
Mutant
MGNA-A449 (yvaX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/449 NBRP B. subtilis, Japan]
BKE33760 ([gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTATTTTTATTTT,  downstream forward: _UP4_TAACATTTAGATAATGGAGA
BKK33760 ([gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33760 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTATTTTTATTTT,  downstream forward: _UP4_TAACATTTAGATAATGGAGA
References
Reviews
20955377
Original Publications
12817086,14651647,15687200,15743949,15687200,17720793,18763711,23687264,21815947,23033921

073D63E17C8248BE39F331FDE9902E21A34056D5

Page visits: 1329

Time of last update: 2021-09-09 16:51:33

Author of last update: Jstuelk