SubtiWiki SubtiWiki
ylaB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ylaB
168

unknown

locus
BSU_14720
Molecular weight
10.70 kDa
pI
4.79
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ylaB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,543,816  1,544,085
The protein
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]-[gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]-[gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
description
[Pubmed|16501307]
regulation
[protein|search|Spx]: transcription activation [Pubmed|16501307]
regulatory mechanism
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [Pubmed|16501307], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16501307], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|544344B61A804F367BB726976E0C87B61998490A|ylaC]: sigma factor, [Pubmed|16501307], in [regulon|protein:544344B61A804F367BB726976E0C87B61998490A|ylaC regulon]
Open in new tab

[gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]→[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]

2021-10-17 17:33:39

ghost

8

7f8af0ac683cfbdb26958147ed94824b4e8127cb

4C1E65F06DFC6C766EDB2CC96642EC3BE04147A6

Biological materials
Mutant
BKE14720 ([gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTTATGATTCATAAAGACT,  downstream forward: _UP4_ATGACGGTGTGGTTTTATTT
BKK14720 ([gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTTATGATTCATAAAGACT,  downstream forward: _UP4_ATGACGGTGTGGTTTTATTT
References
16501307

0703D458DB489F49150DD9E3477A87DC354A7B7F

Page visits: 816

Time of last update: 2021-10-20 07:54:27

Author of last update: Melvin.boenninger