SubtiWiki SubtiWiki
ywzA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywzA
168

general stress protein

locus
BSU_38180
Molecular weight
4.86 kDa
pI
12.49
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ywzA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2261

This gene is a member of the following regulons

Gene
Coordinates
3,918,777  3,919,022
The protein
Protein family
UPF0410 family (with [protein|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS], according to UniProt)
Expression and Regulation
Operons
genes
[gene|050A2F1399C2B0831A24623867875BFEBD02AA71|ywzA]
description
[Pubmed|9353933]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|050A2F1399C2B0831A24623867875BFEBD02AA71|ywzA]

2021-09-17 05:56:16

ghost

3

7358432e2d33e274ec4ada8cc68d9c3bbfb72680

8620AB27E2C286E552C48E64C62E3664E0E3EF6B

Biological materials
Mutant
BKE38180 ([gene|050A2F1399C2B0831A24623867875BFEBD02AA71|ywzA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGCAACACATCCTAT,  downstream forward: _UP4_TAAAAGCAGCAGCACCCGAA
BKK38180 ([gene|050A2F1399C2B0831A24623867875BFEBD02AA71|ywzA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGCAACACATCCTAT,  downstream forward: _UP4_TAAAAGCAGCAGCACCCGAA
References
12884008,11544224

050A2F1399C2B0831A24623867875BFEBD02AA71

Page visits: 1217

Time of last update: 2021-09-16 13:21:14

Author of last update: Melvin.boenninger