SubtiWiki SubtiWiki
mrnC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mrnC
168

RNase Mini-III

locus
BSU_00950
Molecular weight
16.09 kDa
pI
9.15
Protein length
Gene length
function
maturation of 23S rRNA
product
RNase Mini-III
essential
no
synonyms
mrnC, yazC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1939

This gene is a member of the following regulons

Gene
Coordinates
114,854  115,285
The protein
Protein family
MrnC RNase family (single member, according to UniProt)
Structure
[PDB|4OUN] [pubmed|25634891]
Effectors of protein activity
[protein|FEF94BD8482A41C493A8BEC3278B518E8BB4EDFE|rplC] binding to the precursor 23S rRNA stimulates MrnC activity [Pubmed|19154332]
Expression and Regulation
Operons
genes
[gene|132E91DB8C81CD8C4F5160B2C068B74DA10AE224|gltX]-[gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE]-[gene|E5826A99769E2FE45959A9D623D6467A8DDDEB81|cysS]-[gene|031FDF8443A8A4D5B042B7591EBE2E6C74F07702|mrnC]-[gene|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|yacO]-[gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]
description
[Pubmed|7510287]
regulation
expression transiently increases in the forespore [Pubmed|22848659]
the [wiki|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
T-box: transcription antitermination, overlaps a transcription terminator upstream of [gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE], in [regulon|other_regulator:T-box|T-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7510287], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|132E91DB8C81CD8C4F5160B2C068B74DA10AE224|gltX]→[gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]

2021-09-21 18:27:13

Jstuelk

6

9ab774439b3983729fe5811aeaf44f4bc16c609f

BCC6FA512C81F405B92E34AE44A52F949D245F3D

Biological materials
Mutant
MGNA-B883 (yazC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1882 NBRP B. subtilis, Japan]
BKE00950 ([gene|031FDF8443A8A4D5B042B7591EBE2E6C74F07702|mrnC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATCGTATCAAATTCAAGCA,  downstream forward: _UP4_TTCGGGACGTCAGGGAGGAA
BKK00950 ([gene|031FDF8443A8A4D5B042B7591EBE2E6C74F07702|mrnC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TATCGTATCAAATTCAAGCA,  downstream forward: _UP4_TTCGGGACGTCAGGGAGGAA
labs
[wiki|Ciaran Condon], IBPC, Paris, France [http://www.ibpc.fr/UPR9073/condon/index_en.html Homepage]
[wiki|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers Laboratories and Programs/Bechhofer Laboratory?citype=Physician&ciid=Bechhofer David H 1255565 Homepage]
References
19258532,18430137,18363798,8396117,19154332,19880604,25634891,27924926,32991829

031FDF8443A8A4D5B042B7591EBE2E6C74F07702

Page visits: 1992

Time of last update: 2021-10-19 10:04:56

Author of last update: Jstuelk