SubtiWiki SubtiWiki
odhB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

odhB
168

2-oxoglutarate dehydrogenase complex (dihydrolipoamide transsuccinylase, E2 subunit)

locus
BSU_19360
Molecular weight
45.83 kDa
pI
4.86
Protein length
Gene length
function
TCA cycle
product
2-oxoglutarate dehydrogenase complex
essential
no
ec
2.3.1.61
synonyms
odhB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0508

This gene is a member of the following regulons

Gene
Coordinates
2,107,505  2,108,758
The protein
Catalyzed reaction/ biological activity
(R)-N6-dihydrolipoyl-L-lysyl-[2-oxoglutarate dehydrogenase complex component E2] + succinyl-CoA --> (R)-N6-(S8-succinyldihydrolipoyl)-L-lysyl-[2-oxoglutarate dehydrogenase complex component E2] + CoA (according to UniProt)
Protein family
[wiki|2-oxoacid dehydrogenase family] (according to UniProt)
[wiki|Domains]
[wiki|Lipoyl-binding domain] (aa 1-76) (according to UniProt)
[wiki|Peripheral subunit-binding domain] (PSBD) (aa 123-160) (according to UniProt)
[wiki|Cofactors]
lipoic acid (on Lys-42), can be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN] [pubmed|28900027]
Structure
[PDB|3DUF] (EI of the PDH complex from ''Geobacillus stearothermophilus'', 38% identity) [Pubmed|19081062]
Modification
phosphorylated on several Arg residues [Pubmed|24263382]
Paralogous protein(s)
[protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB], [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC], [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]
[wiki|Localization]
membrane associated [Pubmed|18763711]
Additional information
extensive information on the structure and enzymatic properties of 2-oxoglutarate dehydrogenase can be found at [http://www.proteopedia.org/wiki/index.php/2-Oxoglutarate_Dehydrogenase Proteopedia]
Expression and Regulation
Operons
genes
[gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]
description
[Pubmed|11976317]
regulation
repressed by glucose (2.4-fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1508153], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]→[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]

2021-11-26 16:50:16

ghost

10

998628ac6a5b555702d5fa0febcedb0378ac763b

87DE9AE10510310314B50140AE66E41B4448BC3A

Biological materials
Mutant
GP1276 Δ(''[gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])''::''cat'', available in [wiki|Jörg Stülke]'s lab [Pubmed|24178028]
GP2332 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jörg Stülke]'s lab
GP2334 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jörg Stülke]'s lab
BKE19360 ([gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCGCCATTTTTTCATTTC,  downstream forward: _UP4_TAATAAAAAAGGGTACATCA
BKK19360 ([gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCGCCATTTTTTCATTTC,  downstream forward: _UP4_TAATAAAAAAGGGTACATCA
Expression vectors
pGP1145 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Stülke] lab) [Pubmed|20933603]
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Stülke] lab [Pubmed|20933603]
FLAG-tag construct
GP1424 (spc, based on [wiki|pGP1331]), available in the [wiki|Stülke] lab
References
Reviews
10672230,27074917
Original Publications
2500417,1508153,12850135,18763711,12682299,11976317,20933603,24178028,24263382,28900027,19081062,31066113

02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2

Page visits: 2727

Time of last update: 2021-12-03 21:52:03

Author of last update: Melvin.boenninger