SubtiWiki SubtiWiki
odhB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

odhB
168

2-oxoglutarate dehydrogenase complex (dihydrolipoamide transsuccinylase, E2 subunit)

locus
BSU_19360
Molecular weight
45.83 kDa
pI
4.86
Protein length
Gene length
function
TCA cycle
product
2-oxoglutarate dehydrogenase complex
essential
no
ec
2.3.1.61
synonyms
odhB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0508

This gene is a member of the following regulons

Gene
Coordinates
2,107,505  2,108,758
The protein
Catalyzed reaction/ biological activity
(R)-N6-dihydrolipoyl-L-lysyl-[2-oxoglutarate dehydrogenase complex component E2] + succinyl-CoA --> (R)-N6-(S8-succinyldihydrolipoyl)-L-lysyl-[2-oxoglutarate dehydrogenase complex component E2] + CoA (according to UniProt)
Protein family
[wiki|2-oxoacid dehydrogenase family] (according to UniProt)
[wiki|Domains]
[wiki|Lipoyl-binding domain] (aa 1-76) (according to UniProt)
[wiki|Peripheral subunit-binding domain] (PSBD) (aa 123-160) (according to UniProt)
[wiki|Cofactors]
lipoic acid (on Lys-42), can be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN] [pubmed|28900027]
Structure
[PDB|3DUF] (EI of the PDH complex from ''Geobacillus stearothermophilus'', 38% identity) [Pubmed|19081062]
Modification
phosphorylated on several Arg residues [Pubmed|24263382]
Paralogous protein(s)
[protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB], [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC], [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]
[wiki|Localization]
membrane associated [Pubmed|18763711]
Additional information
extensive information on the structure and enzymatic properties of 2-oxoglutarate dehydrogenase can be found at [http://www.proteopedia.org/wiki/index.php/2-Oxoglutarate_Dehydrogenase Proteopedia]
Expression and Regulation
Operons
genes
[gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]
description
[Pubmed|11976317]
regulation
repressed by glucose (2.4-fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1508153], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]→[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]

2021-07-10 01:54:24

ghost

7

998628ac6a5b555702d5fa0febcedb0378ac763b

87DE9AE10510310314B50140AE66E41B4448BC3A

Biological materials
Mutant
GP1276 Δ(''[gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])''::''cat'', available in [wiki|Jörg Stülke]'s lab [Pubmed|24178028]
GP2332 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jörg Stülke]'s lab
GP2334 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jörg Stülke]'s lab
BKE19360 ([gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCGCCATTTTTTCATTTC,  downstream forward: _UP4_TAATAAAAAAGGGTACATCA
BKK19360 ([gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCCGCCATTTTTTCATTTC,  downstream forward: _UP4_TAATAAAAAAGGGTACATCA
Expression vectors
pGP1145 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Stülke] lab) [Pubmed|20933603]
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Stülke] lab [Pubmed|20933603]
FLAG-tag construct
GP1424 (spc, based on [wiki|pGP1331]), available in the [wiki|Stülke] lab
References
Reviews
10672230,27074917
Original Publications
2500417,1508153,12850135,18763711,12682299,11976317,20933603,24178028,24263382,28900027,19081062,31066113

02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2

Page visits: 2641

Time of last update: 2021-09-14 07:35:02

Author of last update: Melvin.boenninger