SubtiWiki SubtiWiki
tkt
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tkt
168

transketolase

locus
BSU_17890
Molecular weight
72.16 kDa
pI
4.8
Protein length
Gene length
function
pentose phosphate pathway
product
transketolase
essential
no
ec
2.2.1.1
synonyms
tkt, tktA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0021

This gene is a member of the following regulons

Gene
Coordinates
1,919,861 1,921,864
The protein
Catalyzed reaction/ biological activity
D-glyceraldehyde 3-phosphate + D-sedoheptulose 7-phosphate --> aldehydo-D-ribose 5-phosphate + D-xylulose 5-phosphate (according to UniProt)
Protein family
transketolase family (with [protein|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|dxs], according to UniProt)
[wiki|Cofactors]
thiamine pyrophosphate
Structure
[PDB|3HYL], from B. anthracis
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]
description
[Pubmed|9068642]
regulation
repressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
Open in new tab

[gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]

2021-08-27 00:26:27

ghost

11

d240d8227b7d8c578e94612a78aba536e2ea480a

C39BC58B4A730B78F354000493D0F89AF615BED8

Biological materials
Mutant
BS4530 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::aphA3), available in [wiki|Jrg Stlke]'s lab
BKE17890 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCCCTTCCTTA, downstream forward: _UP4_TAAGCTTTTGAAAGAGGATG
BKK17890 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCCCTTCCTTA, downstream forward: _UP4_TAAGCTTTTGAAAGAGGATG
Expression vectors
pGP94 (N-terminal Strep-tag, for [wiki|SPINE], expression in B. subtilis, in [wiki|pGP380]), available in [wiki|Jrg Stlke]'s lab
for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172]: pGP820, available in [wiki|Jrg Stlke]'s lab, [pubmed|20389117]
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
FLAG-tag construct
GP1406 (spc, based on [wiki|pGP1331]), available in [wiki|Jrg Stlke]'s lab
References
Reviews
9924800,25267444,24929114
Original Publications
14651647,16493705,19603213,9068642,16143417,15375635,19193632,23568212,23965678,15378759

000E237B00539E6850B6A50EE01BA02844B6ACBC

Page visits: 2484

Time of last update: 2021-09-18 11:31:17

Author of last update: Christoph