SubtiBank SubtiBank
Version comparison:

Thu Oct 01 2015 13:51:44 GMT+0200 (CEST)2025-05-25 01:53:10

locus

BSU29180

BSU_29180

outlinks

bsu

BSU29180

BSU_29180

[SW|Categories] containing this gene/protein

[SW|ATP synthesis], [SW|carbon core metabolism], [SW|phosphoproteins], [SW|most abundant proteins]

Gene

Coordinates on the chromosome (coding sequence)

2,984,788 -> 2,986,545

Gene

Phenotypes of a mutant

unable to grow with non-[SW|PTS] carbohydrates (such as glucitol or glycerol) as single carbon source

suppression of ''[[protein|ftsZ]]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]

unable to grow with non-[[protein|PtsI]] carbohydrates (such as glucitol or glycerol) as single carbon source

suppression of ''[[gene|ftsZ]]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]

The protein

Catalyzed reaction/ biological activity

ADP phosphoenolpyruvate --> ATP pyruvate

The reaction is irreversible under physiological conditions

ADP + phosphoenolpyruvate → ATP + pyruvate

The reaction is irreversible under physiological conditions

The protein

Protein family

PEP-utilizing enzyme family (according to Swiss-Prot) pyruvate kinase family, (C-terminal section: PEP-utilizing enzyme family)

C-terminal part: [SW|PEP-utilizing enzyme family] (according to UniProt)

pyruvate kinase family (single member, according to UniProt)

The protein

[SW|Cofactors]

Mg2, K

Mg2+, K+

The protein

Structure

[PDB|2E28] (Geobacillus stearothermophilus)

[PDB|2E28] (Geobacillus stearothermophilus) [pubmed|18511452]

The protein

Additional information

The enzyme is a tetramer with four active sites [Pubmed|3711058]

The enzyme is a tetramer with four active sites [Pubmed|3711058]

belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]

Expression and Regulation

Operon

''[[protein|pfkA]]-[[protein|pyk]]-[[protein|ytzA]]'' [Pubmed|11489127]

Expression and Regulation

Regulation

twofold induced by glucose [Pubmed|11489127]

Expression and Regulation

Additional information

belongs to the 100 [[most abundant proteins]] [PubMed|15378759]

Biological materials

Mutant

GP589 (''pyk''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]

GP600 (''pyk''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]

GP1745: ''pyk::aphA3'', available in [SW|Jörg Stülke]' lab

GP589 (''pyk''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]

GP600 (''pyk''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]

GP1745: BSB1 ''pyk::aphA3'', available in [SW|Jörg Stülke]' lab

BKE29180 (Δ[[gene|pyk]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA

BKK29180 (Δ[[gene|pyk]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA

Biological materials

Expression vector

expression in ''E. coli'', N-terminal His-tag: pGP1100 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

expression in ''B. subtilis'', native protein: pGP1411 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

expression in ''B. subtilis'', N-terminal Strep-tag: pGP1409 (in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab

expression in ''B. subtilis'', C-terminal Strep-tag: pGP1410 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab

Biological materials

lacZ fusion

see ''[[protein|pfkA]]

see ''[[gene|pfkA]]

Biological materials

two-hybrid system

''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab

''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]

Labs working on this gene/protein

[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

References

17726680, 16493705, 11489127, 17505547, 10966427, 17218307, 3711058, 4623707, 21821766, 22846916, 23420519, 24158146, 24571712, 15378759, 24825009

17726680, 16493705, 11489127, 17505547, 10966427, 17218307, 3711058, 4623707, 21821766, 22846916, 23420519, 24158146, 24571712, 15378759, 24825009, 28516784, 18511452, 31590319

proteinLength

585

geneLength

1758

Gene

Coordinates

2,984,788 → 2,986,545

The protein

Paralogous protein(s)

[[this]]

Expression and Regulation

Operons

[[this]]

Expression and Regulation

Other regulations

[[this]]

Biological materials

Expression vectors

expression in ''E. coli'', N-terminal His-tag: pGP1100 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]

expression in ''B. subtilis'', native protein: pGP1411 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

expression in ''B. subtilis'', N-terminal Strep-tag: pGP1409 (in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab

expression in ''B. subtilis'', C-terminal Strep-tag: pGP1410 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab

labs

[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]