two-component response regulator, regulation of degradative enzyme expression, [SW|genetic competence], [SW|biofilm formation], capsule biosynthesis (together with [[protein|SwrAA]]), non-phosphorylated DegU is required for swarming motility

two-component response regulator, regulation of degradative enzyme expression, [SW|genetic competence], [SW|biofilm formation], capsule biosynthesis (together with [[protein|SwrA]]), non-phosphorylated DegU is required for swarming motility

BSU35490

BSU_35490

687

690

BSU35490

BSU_35490

[[protein|DegU]]-P is degraded by [[protein|ClpC]]-[[protein|ClpP]] [Pubmed|20070525]

accumulation of [[protein|DegU]]-P results in decreased transcription of the [[gene|epsA]]-[[gene|epsO]] and [[gene|tapA]]-[[gene|sipW]]-[[gene|tasA]] operons due to increased levels of [[protein|Spo0A]]-P [Pubmed|24123822]

[[protein|DegU]]-P is degraded by [[protein|ClpC]]-[[protein|ClpP]] [Pubmed|20070525]

accumulation of [[protein|DegU]]-P results in decreased transcription of the [[gene|epsA]]-[[gene|epsO]] and [[gene|tapA]]-[[gene|sipW]]-[[gene|tasA]] operons due to increased levels of [[protein|Spo0A]]-P [Pubmed|24123822]

information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000030 PRODORIC2 database]

BKE35490 (Δ[[gene|degU]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT, downstream forward: _UP4_TAGTATAATAGGAGACTTGC

BKK35490 (Δ[[gene|degU]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT, downstream forward: _UP4_TAGTATAATAGGAGACTTGC

GP2644([[gene|degU]]::''aphA3''), available in [SW|Jörg Stülke]'s lab

BKE35490 (Δ[[gene|degU]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT, downstream forward: _UP4_TAGTATAATAGGAGACTTGC

BKK35490 (Δ[[gene|degU]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGCCACGCCTCCTTGT, downstream forward: _UP4_TAGTATAATAGGAGACTTGC

17850253, 8878039, 14563871, 1901568, 1321152, 1459944, 18194340, 18978066, 10908654, 18502860, 10094672, 19389763, 20815827, 21742882, 18414485, 19420703, 2428811, 7746142, 18502860, 19389763, 19416356, 19734658, 1688843, 20070525, 18197985, 15598897, 12950930, 17590234, 8955341, 22496484, 22745669, 23123903, 21965392, 24123822, 24296669, 122328658, 23888912, 24149708, 24317403, 25431404, 25433860, 24386445, 25777015, 25880922, 25887289, 25755103, 26819068, 23650349, 27026185, 27920766, 28800172, 29124898

17850253, 8878039, 14563871, 1901568, 1321152, 1459944, 18194340, 18978066, 10908654, 18502860, 10094672, 19389763, 20815827, 21742882, 18414485, 19420703, 2428811, 7746142, 18502860, 19389763, 19416356, 19734658, 1688843, 20070525, 18197985, 15598897, 12950930, 17590234, 8955341, 22496484, 22745669, 23123903, 21965392, 24123822, 24296669, 122328658, 23888912, 24149708, 24317403, 25431404, 25433860, 24386445, 25777015, 25880922, 25887289, 25755103, 26819068, 23650349, 27026185, 27920766, 28800172, 29124898, 33144634

[[this]]

[SW|Response regulatory domain] (aa 5-121) (according to UniProt)

[SW|HTH luxR-type domain] (aa 159-224) (according to UniProt)