BSU23860

BSU_23860

BSU23860

BSU_23860

6-phospho-D-gluconate + NADP⁺ = D-ribulose 5-phosphate + CO₂ + NADPH (according to Swiss-Prot)

6-phospho-D-gluconate + NADP⁺ --> CO₂ + D-ribulose 5-phosphate + NADPH (according to UniProt)

6-phosphogluconate dehydrogenase family (according to Swiss-Prot)

6-phosphogluconate dehydrogenase family (with [[protein|YqeC]] and [[protein|GntZ]], according to UniProt)

[PDB|2W8Z] (from ''Geobacillus stearothermophilus'', 83% identity, 92% similarity) [Pubmed|19407374]

[PDB|2W8Z] (from ''Geobacillus stearothermophilus'', 83% identity, 92% similarity) [Pubmed|19407374]

MGNA-C391 (yqjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2389 NBRP B. subtilis, Japan]

GP1514 (''gndA''::''kan''), available in [SW|Jrg Stlke]'s lab

BKE23860 ([[gene|gndA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA

BKK23860 ([[gene|gndA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA

MGNA-C391 (yqjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2389 NBRP B. subtilis, Japan]

GP1514 (''gndA''::''kan''), available in [SW|Jörg Stülke]'s lab

BKE23860 ([[gene|gndA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA

BKK23860 ([[gene|gndA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA

pGP1777 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jrg Stlke]'s lab)

pGP1789 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP1389]) (available in [SW|Jrg Stlke]'s lab)

GP1408 (''gndA''-''Strep'' ''(spc)'') & GP1410 (''gndA''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jrg Stlke]'s lab

pGP1777 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab)

pGP1789 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP1389]) (available in [SW|Jörg Stülke]'s lab)

GP1408 (''gndA''-''Strep'' ''(spc)'') & GP1410 (''gndA''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jrg Stlke]'s lab

''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab

GP1403 (spc, based on [SW|pGP1331]), available in [SW|Jrg Stlke]'s lab

GP1408 (kan, resistance cassette exchange in GP1403), available in [SW|Jrg Stlke]'s lab

GP1403 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab

GP1408 (kan, resistance cassette exchange in GP1403), available in [SW|Jörg Stülke]'s lab

**

17218307, 19407374, 15378759, 15231785, 26883633

17218307, 19407374, 15378759, 15231785, 26883633, 30948730

inhibited by 4-phosphoerythronate (results from oxidation of erythrose-4-phosphate) [pubmed|30948730]