SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


putative S-(2-succino)cysteine [SW|ABC transporter] (permease)
24.86 kDa
protein length
224 aa Sequence Blast
gene length
675 bp Sequence Blast
uptake and utilization of S-(2-succino)cysteine
putative S-(2-succino)cysteine [SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of cysteine]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|Conversion of S-(2-succino)cysteine to cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,058,791 → 4,059,465

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|TcyL], [protein|9400DF25487461E3738DDDC72BDDB1589281409D|TcyB], [protein|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|YckA]
  • Structure

  • [PDB|4YMS] (amino acid transporter from Caldanaerobacter subterraneus, 39% identity) [pubmed|25848002]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]) [Pubmed|16513748]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-B710 (yxeN::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A950 ( ''yxeN''::''cat''), [Pubmed|15262924], available at [ BGSC]
  • BKE39490 (Δ[gene|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|yxeN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGGTGAGTCACCGCC, downstream forward: _UP4_TACCGGACTTAGAGGTGAAA
  • BKK39490 (Δ[gene|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|yxeN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGGTGAGTCACCGCC, downstream forward: _UP4_TACCGGACTTAGAGGTGAAA
  • References

  • 10746760,10092453,16513748,18763711,29626092,25848002