SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to [SW|ABC transporter] (membrane protein)
51.75 kDa
protein length
486 aa Sequence Blast
gene length
1461 bp Sequence Blast
[SW|ABC transporter] (membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    424,904 → 426,364

    The protein

    Protein family

  • [SW|ABC-4 integral membrane protein family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • view in new tab

    Biological materials


  • MGNA-C006 (yclI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03740 (Δ[gene|FFCC02FA996D570C69F79AAC22C2C4FCAD9E89D9|yclI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTTCCTCCGTATA, downstream forward: _UP4_TAGAAAGAGGCGGAACCTAT
  • BKK03740 (Δ[gene|FFCC02FA996D570C69F79AAC22C2C4FCAD9E89D9|yclI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTTCCTCCGTATA, downstream forward: _UP4_TAGAAAGAGGCGGAACCTAT
  • References

  • 10092453,20512483,21630458