SubtiBank SubtiBank
ygaC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ygaC

unknown
locus
BSU_08680
pI
5.18
mw
21.01 kDa
protein length
176 aa Sequence Blast
gene length
531 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    938,731 → 939,261

    The protein

    Protein family

  • UPF0374 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|FFC7595CD0930089B768BB36816A3FE470501236|ygaC]-[gene|0EB4D3E1B9AF39ECCBD79EB559FAE5BB0EE4C156|ygaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE08680 (Δ[gene|FFC7595CD0930089B768BB36816A3FE470501236|ygaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCTCCCCTACTTTC, downstream forward: _UP4_TAATGGTTACGTAAAAACCT
  • BKK08680 (Δ[gene|FFC7595CD0930089B768BB36816A3FE470501236|ygaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCTCCCCTACTTTC, downstream forward: _UP4_TAATGGTTACGTAAAAACCT
  • GP2686 (Δ[gene|FFC7595CD0930089B768BB36816A3FE470501236|ygaC]::spc trpC2), available, in [SW|Jörg Stülke]'s lab
  • References

    Research papers

  • 27422825