SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


21.01 kDa
protein length
176 aa Sequence Blast
gene length
531 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    938,731 → 939,261

    The protein

    Protein family

  • UPF0374 family (single member, according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE08680 (Δ[gene|FFC7595CD0930089B768BB36816A3FE470501236|ygaC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCTCCCCTACTTTC, downstream forward: _UP4_TAATGGTTACGTAAAAACCT
  • BKK08680 (Δ[gene|FFC7595CD0930089B768BB36816A3FE470501236|ygaC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCTCCCCTACTTTC, downstream forward: _UP4_TAATGGTTACGTAAAAACCT
  • GP2686 (Δ[gene|FFC7595CD0930089B768BB36816A3FE470501236|ygaC]::spc trpC2), available, in [SW|Jörg Stülke]'s lab
  • Expression vector

  • pGP2338: expression of ygaC via [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

    Research papers

  • 27422825