SubtiBank SubtiBank
ypdA [2019-01-14 08:46:58]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypdA [2019-01-14 08:46:58]

similar to thioredoxin reductase
locus
BSU22950
pI
6.08
mw
36.18 kDa
protein length
324 aa Sequence Blast
gene length
972 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,400,984 → 2,401,958

    The protein

    Protein family

  • Trx reductase family
  • Structure

  • [PDB|4ZN0] (from Methanosarcina mazei, 27% identity)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Biological materials

    Mutant

  • MGNA-A398 (ypdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/398 NBRP B. subtilis, Japan]
  • BKE22950 (Δ[gene|FF7440B70CCB5A9C443944E0259D845A958EA279|ypdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGTCAACTCCTGCG, downstream forward: _UP4_TAAAGATGAGGAGCATATGA
  • BKK22950 (Δ[gene|FF7440B70CCB5A9C443944E0259D845A958EA279|ypdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGTCAACTCCTGCG, downstream forward: _UP4_TAAAGATGAGGAGCATATGA
  • References

  • 20308541