SubtiBank SubtiBank
ypdA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ypdA

putative bacillithiol reductase
locus
BSU_22950
pI
6.08
mw
36.18 kDa
protein length
324 aa Sequence Blast
gene length
975 bp Sequence Blast
function
recycling of oxidized bacillithiol disulfide to the reduced form (BSH)
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,400,984 → 2,401,958

    The protein

    Catalyzed reaction/ biological activity

  • recycling of oxidized bacillithiol disulfide (BSSB) to the reduced form (BSH) [pubmed|30636083]
  • Structure

  • [PDB|4ZN0] (from Methanosarcina mazei, 27% identity)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Biological materials

    Mutant

  • MGNA-A398 (ypdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/398 NBRP B. subtilis, Japan]
  • BKE22950 (Δ[gene|FF7440B70CCB5A9C443944E0259D845A958EA279|ypdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGTCAACTCCTGCG, downstream forward: _UP4_TAAAGATGAGGAGCATATGA
  • BKK22950 (Δ[gene|FF7440B70CCB5A9C443944E0259D845A958EA279|ypdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGTCAACTCCTGCG, downstream forward: _UP4_TAAAGATGAGGAGCATATGA
  • References

  • 20308541,30636083