SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


putative bacillithiol reductase
36.18 kDa
protein length
324 aa Sequence Blast
gene length
975 bp Sequence Blast
recycling of oxidized bacillithiol disulfide to the reduced form (BSH)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,400,984 → 2,401,958

    The protein

    Catalyzed reaction/ biological activity

  • recycling of oxidized bacillithiol disulfide (BSSB) to the reduced form (BSH) [pubmed|30636083]
  • Protein family

  • Trx reductase family
  • Structure

  • [PDB|4ZN0] (from Methanosarcina mazei, 27% identity)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Biological materials


  • MGNA-A398 (ypdA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22950 (Δ[gene|FF7440B70CCB5A9C443944E0259D845A958EA279|ypdA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGTCAACTCCTGCG, downstream forward: _UP4_TAAAGATGAGGAGCATATGA
  • BKK22950 (Δ[gene|FF7440B70CCB5A9C443944E0259D845A958EA279|ypdA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGTCAACTCCTGCG, downstream forward: _UP4_TAAAGATGAGGAGCATATGA
  • References

  • 20308541,30636083