SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|Nudix hydrolase], similar to mutator [protein|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|MutT] protein
19.23 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    1,290,018 → 1,290,644

    The protein

    Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • Structure

  • [PDB|3Q1P] (from ''B. cereus'', 42% identity, 77% similarity) [Pubmed|21531795]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A375 (yjhB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12190 (Δ[gene|FF6A150806407E7D10C090FA2CDB521DDC7811F9|yjhB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCATCCTTTCAAGTCAA, downstream forward: _UP4_TAAAAAAGAAAGAGCCTGTG
  • BKK12190 (Δ[gene|FF6A150806407E7D10C090FA2CDB521DDC7811F9|yjhB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCATCCTTTCAAGTCAA, downstream forward: _UP4_TAAAAAAGAAAGAGCCTGTG
  • References

  • 27766092