SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


S-ribosylhomocysteine lyase, autoinducer-2 production protein, required for surface spreading motility (sliding) of B. subtilis natto and biofilm formation
17.57 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
methionine salvage
S-ribosylhomocysteine lyase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    3,137,495 → 3,137,968

    The protein

    Catalyzed reaction/ biological activity

  • S-(5-deoxy-D-ribos-5-yl)-L-homocysteine --> (S)-4,5-dihydroxypentane-2,3-dione + L-homocysteine (according to UniProt)
  • Protein family

  • luxS family (single member, according to UniProt)
  • Effectors of protein activity

  • subject to feedback inhibition [Pubmed|19258532]
  • Structure

  • [PDB|1JQW] (complex with homocysteine), [PDB|1J98] [Pubmed|11601850]
  • Expression and Regulation



    additional information

  • subject to feedback inhibition [ PubMed]
  • view in new tab


    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials


  • MGNA-B540 (ytjB::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A953 ( ''luxS''::''cat''), [Pubmed|17056751], available at [ BGSC]
  • BKE30670 (Δ[gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGCACTCTCCCCTT, downstream forward: _UP4_TAAAATAGAAAGGACCTTTT
  • BKK30670 (Δ[gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGCACTCTCCCCTT, downstream forward: _UP4_TAAAATAGAAAGGACCTTTT
  • References

  • 11553770,19258532,9387221,16740951,26779171,17056751,11601850