SubtiBank SubtiBank
luxS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

luxS

S-ribosylhomocysteine lyase, autoinducer-2 production protein, required for surface spreading motility (sliding) of B. subtilis natto and biofilm formation
locus
BSU30670
pI
5.17
mw
17.57 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
methionine salvage
product
S-ribosylhomocysteine lyase
essential
no
ec
4.4.1.21
synonyms
ytjB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    3,137,495 → 3,137,968

    The protein

    Catalyzed reaction/ biological activity

  • S-(5-deoxy-D-ribos-5-yl)-L-homocysteine = L-homocysteine + (4S)-4,5-dihydroxypentan-2,3-dione (according to Swiss-Prot)
  • Protein family

  • luxS family (according to Swiss-Prot)
  • Effectors of protein activity

  • subject to feedback inhibition [Pubmed|19258532]
  • Structure

  • [PDB|1JQW] (complex with homocysteine), [PDB|1J98] [Pubmed|11601850]
  • Expression and Regulation

    Operons

    genes
    [gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]
    description
    [Pubmed|9387221]

    additional information

  • subject to feedback inhibition [http://www.ncbi.nlm.nih.gov/sites/entrez/19258532 PubMed]
  • view in new tab

    genes
    [gene|F942C0F4618FACEF35ACA629355BAC288556E7B6|ytiB]-[gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B540 (ytjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1539 NBRP B. subtilis, Japan]
  • 1A953 ( ''luxS''::''cat''), [Pubmed|17056751], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A953&Search=1A953 BGSC]
  • BKE30670 (Δ[gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGCACTCTCCCCTT, downstream forward: _UP4_TAAAATAGAAAGGACCTTTT
  • BKK30670 (Δ[gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGCACTCTCCCCTT, downstream forward: _UP4_TAAAATAGAAAGGACCTTTT
  • References

  • 11553770,19258532,9387221,16740951,26779171,17056751,11601850