SubtiBank SubtiBank
luxS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

luxS

S-ribosylhomocysteine lyase, autoinducer-2 production protein, required for surface spreading motility (sliding) of B. subtilis natto and biofilm formation
locus
BSU_30670
pI
5.17
mw
17.57 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
methionine salvage
product
S-ribosylhomocysteine lyase
essential
no
ec
4.4.1.21
synonyms
ytjB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    3,137,495 → 3,137,968

    The protein

    Catalyzed reaction/ biological activity

  • S-(5-deoxy-D-ribos-5-yl)-L-homocysteine --> (S)-4,5-dihydroxypentane-2,3-dione + L-homocysteine (according to UniProt)
  • Protein family

  • luxS family (single member, according to UniProt)
  • Effectors of protein activity

  • subject to feedback inhibition [Pubmed|19258532]
  • Structure

  • [PDB|1JQW] (complex with homocysteine), [PDB|1J98] [Pubmed|11601850]
  • Expression and Regulation

    Operons

    genes
    [gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]
    description
    [Pubmed|9387221]

    additional information

  • subject to feedback inhibition [http://www.ncbi.nlm.nih.gov/sites/entrez/19258532 PubMed]
  • view in new tab

    genes
    [gene|F942C0F4618FACEF35ACA629355BAC288556E7B6|ytiB]-[gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B540 (ytjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1539 NBRP B. subtilis, Japan]
  • 1A953 ( ''luxS''::''cat''), [Pubmed|17056751], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A953&Search=1A953 BGSC]
  • BKE30670 (Δ[gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGCACTCTCCCCTT, downstream forward: _UP4_TAAAATAGAAAGGACCTTTT
  • BKK30670 (Δ[gene|FF61DC6CA162EEC191CDFC802E721FCBD32EC098|luxS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGCACTCTCCCCTT, downstream forward: _UP4_TAAAATAGAAAGGACCTTTT
  • References

  • 11553770,19258532,9387221,16740951,26779171,17056751,11601850