SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


2-oxoglutarate permease (proton symporter)
45.22 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast
uptake of alpha-ketoglutarate
2-oxoglutarate permease (proton symporter)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,021,223 → 2,022,467

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|12B260DBC4E29151364251837FD227593D0BF391|CsbX]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-A833 (yoaB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18540 (Δ[gene|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTCTCCTCCTTAG, downstream forward: _UP4_TAATTAGAAAGCGCCCTGTT
  • BKK18540 (Δ[gene|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTCTCCTCCTTAG, downstream forward: _UP4_TAATTAGAAAGCGCCCTGTT
  • References

  • 12107147,18763711,10094622,18039762