SubtiBank SubtiBank
ksgA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ksgA

rRNA adenine dimethyltransferase
locus
BSU_00420
pI
5.71
mw
32.57 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
function
rRNA maturation
product
rRNA adenine dimethyltransferase
essential
no
ec
2.1.1.-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • Gene

    Coordinates
    50,640 → 51,518

    The protein

    Catalyzed reaction/ biological activity

  • adenosine1518/adenosine1519 in 16S rRNA + 4 S-adenosyl-L-methionine --> 4 H+ + N6-dimethyladenosine1518/N6-dimethyladenosine1519 in 16S rRNA + 4 S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|6IFT] (complexed with S-adenosylmethionine) [Pubmed|30624914]
  • [PDB|6IFS] [Pubmed|30624914]
  • [PDB|6IFV] (C-terminal truncation) [Pubmed|30624914]
  • [PDB|6IFW] (Chimeric protein) [Pubmed|30624914]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5BA7AA691CFE4635DEFBD0B8B820F487B58A5DB7|rnmV]-[gene|FF329359CBE52C75A39237E8A6BB56F6AB321AFB|ksgA]
    description
    [Pubmed|11233981]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B907 (ksgA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1906 NBRP B. subtilis, Japan]
  • BKE00420 (Δ[gene|FF329359CBE52C75A39237E8A6BB56F6AB321AFB|ksgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATTCATTCTGTTCCTC, downstream forward: _UP4_TAAAAGGGCTTTTTGTTTTG
  • BKK00420 (Δ[gene|FF329359CBE52C75A39237E8A6BB56F6AB321AFB|ksgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATTCATTCTGTTCCTC, downstream forward: _UP4_TAAAAGGGCTTTTTGTTTTG
  • References

  • 16497325,19001112,11233981,19285505,30624914