SubtiBank SubtiBank
yhdH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhdH

similar to sodium-dependent transporter
locus
BSU_09470
pI
9.75
mw
48.78 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,024,865 → 1,026,220

    The protein

    Protein family

  • sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family (with [protein|D5A30C841A142B49C50A38936802D0F60485DD7C|YocR], according to UniProt)
  • Paralogous protein(s)

  • [protein|D5A30C841A142B49C50A38936802D0F60485DD7C|YocR]
  • Structure

  • [PDB|4US4] (the protein from ''B. halodurans'', 44% identity, 75% similarity) [Pubmed|25282149]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|FF16BA2B744E89AADB00F936B9A50A82726312A7|yhdH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A693 (yhdH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/693 NBRP B. subtilis, Japan]
  • BKE09470 (Δ[gene|FF16BA2B744E89AADB00F936B9A50A82726312A7|yhdH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAACGTCACTTCCTTT, downstream forward: _UP4_TAAAAAACAGGCTCCGTTTC
  • BKK09470 (Δ[gene|FF16BA2B744E89AADB00F936B9A50A82726312A7|yhdH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAACGTCACTTCCTTT, downstream forward: _UP4_TAAAAAACAGGCTCCGTTTC
  • References

  • 25282149,22383849