SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


class III heat-shock ATP-dependent protease
86.42 kDa
protein length
774 aa Sequence Blast
gene length
2325 bp Sequence Blast
protein quality control, control of swarming motility
class III heat-shock ATP-dependent protease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    2,880,466 → 2,882,790

    Phenotypes of a mutant

  • presence of predifferentiated swarmer cells in liquid medium [Pubmed|25538299]
  • The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of proteins in presence of ATP (according to UniProt)
  • inhibits swarming motility by preventing accumulation of SwrA in liquid medium [Pubmed|25538299]
  • Protein family

  • Peptidase S16 family (with [protein|1A5C1BDE844AA56B90C0E4A02D74978676487E99|DdcP] and [protein|CA90AAE5320C20F93F5ED0F167294C28495756FF|LonB], according to UniProt)
  • Structure

  • [PDB|5E7S] (active hexamer from ''Meiothermus taiwanensis'', 63% identity, 89% similarity) [Pubmed|27041593]
  • [PDB|4YPN] (ADP-bound hexamer from ''Meiothermus taiwanensis'', 63% identity, 89% similarity) [Pubmed|27041592]
  • [PDB|3M65] (N-terminal domain) [Pubmed|20600124]
  • [PDB|3M6A] (C-terminal domain) [Pubmed|20600124]
  • [PDB|1X37] (Ssd domain)
  • [SW|Localization]

  • coincident with the nucleoid during normal growth and localized to the forespore during development [Pubmed|18689473]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7961402], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|9852015], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • induced by heat stress ([protein|search|CtsR]) [Pubmed|9852015]
  • view in new tab

    Biological materials


  • BKE28200 (Δ[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACTGACACCTCCGT, downstream forward: _UP4_AAATGAAAGTCACAAAGTCA
  • BKK28200 (Δ[gene|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACTGACACCTCCGT, downstream forward: _UP4_AAATGAAAGTCACAAAGTCA
  • References


  • 23479438,26639779
  • Original publications

  • 7961403,7961402,19542270,19643080,9852015,18689473,20600124,25538299,27041592,27041593,29311275