SubtiBank SubtiBank
yyaE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yyaE

similar to formate dehydrogenase
locus
BSU_40930
pI
5.16
mw
73.75 kDa
protein length
667 aa Sequence Blast
gene length
2004 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    Coordinates
    4,201,070 → 4,203,073

    The protein

    Protein family

  • [SW|prokaryotic molybdopterin-containing oxidoreductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|628CCADB3C9A5F8A128C44ADE1DFDC2FC6B3CD01|YoaE]
  • [SW|Domains]

  • [SW|4Fe-4S Mo/W bis-MGD-type domain] (aa 2-59) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|2VPW] (from Thermus thermophilus, 26% identity) [pubmed|18536726]
  • Expression and Regulation

    Operons

    genes
    [gene|BD162A17E5F3F9AB49E478CE72D0FE92D82E6673|yyzM]-[gene|FEE1952DFA3D6A5E2DC108B3B203B526642E2C68|yyaE]-[gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]-[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B870 (yyaE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1869 NBRP B. subtilis, Japan]
  • BKE40930 (Δ[gene|FEE1952DFA3D6A5E2DC108B3B203B526642E2C68|yyaE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCCGTCTTCTCCTTAC, downstream forward: _UP4_TAATCAAAGGGATTGGCAAG
  • BKK40930 (Δ[gene|FEE1952DFA3D6A5E2DC108B3B203B526642E2C68|yyaE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCCGTCTTCTCCTTAC, downstream forward: _UP4_TAATCAAAGGGATTGGCAAG
  • References

    Research papers

  • 18536726