SubtiBank SubtiBank
ansA [2019-02-24 17:55:09]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ansA [2019-02-24 17:55:09]

36.30 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
asparagine degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of asparagine/ aspartate]
  • Gene

    2,455,819 → 2,456,808

    The protein

    Catalyzed reaction/ biological activity

  • L-asparagine + H2O = L-aspartate + NH3 (according to Swiss-Prot)
  • Protein family

  • asparaginase 1 family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|B5301B346FBAAE2D7C37D561FE1DCFDDFAC90D40|AnsZ]
  • Structure

  • [PDB|5OT0] (from Thermococcus kodakarensis, 43% identity) [pubmed|29095161]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1711029], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|146947C974D62BCB282BA3F5B924B35695D75886|AnsR]: repression, [Pubmed|11914346], in [regulon|146947C974D62BCB282BA3F5B924B35695D75886|AnsR regulon]
  • regulation

  • expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab



  • ''[protein|search|ansA]'': expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab

    Biological materials


  • GP1153 (del ''ansAB''::''ermC'') available in the [SW|Stülke] lab
  • BKE23580 (Δ[gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCATGCACCTCTTCAC, downstream forward: _UP4_TAAAATGTAAAAACGATAAC
  • BKK23580 (Δ[gene|FED8E46AA1C4EFD27796D5DFBBB1663EBF336BFD|ansA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCATGCACCTCTTCAC, downstream forward: _UP4_TAAAATGTAAAAACGATAAC
  • lacZ fusion

  • pGP872 (in [SW|pAC5]), available in [SW|Stülke] lab
  • References

  • 8478318,1711029,11914346,22383849,29095161