SubtiBank SubtiBank
yabE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yabE

similar to cell wall binding protein
locus
BSU_00400
pI
9.28
mw
47.55 kDa
protein length
437 aa Sequence Blast
gene length
1314 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • Gene

    Coordinates
    48,629 → 49,942

    The protein

    [SW|Domains]

  • G5 domain (aa 236-316) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|FEC200568646319DBFAD3A7E20AFA1CF5185EFB2|yabE]
    description
    [Pubmed|19047346]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19047346], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • expression is negatively controlled by a cis-acting antisense RNA that is dependent on [protein|search|SigX] and [protein|search|SigM] [http://www.ncbi.nlm.nih.gov/sites/entrez/19047346 PubMed]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B905 (yabE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1904 NBRP B. subtilis, Japan]
  • BKE00400 (Δ[gene|FEC200568646319DBFAD3A7E20AFA1CF5185EFB2|yabE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGCTCAGTGTCCTCTT, downstream forward: _UP4_TAGTATATACTTATGTATTC
  • BKK00400 (Δ[gene|FEC200568646319DBFAD3A7E20AFA1CF5185EFB2|yabE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGCTCAGTGTCCTCTT, downstream forward: _UP4_TAGTATATACTTATGTATTC
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

  • 19047346,26883633