SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transporter for citrate (proton symport)
48.18 kDa
protein length
450 aa Sequence Blast
gene length
1353 bp Sequence Blast
citrate uptake
transporter for citrate (proton symport)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,979,753 → 3,981,105

    The protein

    Catalyzed reaction/ biological activity

  • uptake of citrate (symport with protons) [Pubmed|11566984]
  • Protein family

  • sodium:citrate (SCF) symporter family (together with [protein|F8F62635AA87E4E3A255D6F8FC621EF40954B520|MaeN], according to UniProt)
  • Paralogous protein(s)

  • [protein|F8F62635AA87E4E3A255D6F8FC621EF40954B520|MaeN]
  • Structure

  • [PDB|5X9R] (from Klebsiella pneumoniae, 34% identity) [pubmed|28566738]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-B744 (yxkJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38770 (Δ[gene|FEC0EDE9663FE62B2A1A4FA5B16B41048DDD723B|cimH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAAAAACCTCCCCTAT, downstream forward: _UP4_TGATCCCCGCAAGCAAGTTC
  • BKK38770 (Δ[gene|FEC0EDE9663FE62B2A1A4FA5B16B41048DDD723B|cimH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAAAAACCTCCCCTAT, downstream forward: _UP4_TGATCCCCGCAAGCAAGTTC
  • References


  • 16339740
  • Original publications

  • 12525174,10666464,11566984,21815947,28566738