SubtiBank SubtiBank
cimH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cimH

transporter for citrate (proton symport)
locus
BSU38770
pI
6.55
mw
48.18 kDa
protein length
450 aa Sequence Blast
gene length
1353 bp Sequence Blast
function
citrate uptake
product
transporter for citrate (proton symport)
essential
no
synonyms
yxkJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,979,753 → 3,981,105

    The protein

    Catalyzed reaction/ biological activity

  • uptake of citrate (symport with protons) [Pubmed|11566984]
  • Protein family

  • sodium:citrate (SCF) symporter family 2-hydroxycarboxylate transporter family (together with [protein|F8F62635AA87E4E3A255D6F8FC621EF40954B520|MaeN]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|F8F62635AA87E4E3A255D6F8FC621EF40954B520|MaeN]
  • Structure

  • [PDB|5X9R] (from Klebsiella pneumoniae, 34% identity) [pubmed|28566738]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|FEC0EDE9663FE62B2A1A4FA5B16B41048DDD723B|cimH]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B744 (yxkJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1743 NBRP B. subtilis, Japan]
  • BKE38770 (Δ[gene|FEC0EDE9663FE62B2A1A4FA5B16B41048DDD723B|cimH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAAAAACCTCCCCTAT, downstream forward: _UP4_TGATCCCCGCAAGCAAGTTC
  • BKK38770 (Δ[gene|FEC0EDE9663FE62B2A1A4FA5B16B41048DDD723B|cimH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAAAAACCTCCCCTAT, downstream forward: _UP4_TGATCCCCGCAAGCAAGTTC
  • References

    Reviews

  • 16339740
  • Original publications

  • 12525174,10666464,11566984,21815947,28566738