SubtiBank SubtiBank
pbpE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pbpE

penicillin-binding protein PBP 4* (spore cortex)
locus
BSU34440
pI
4.84
mw
51.27 kDa
protein length
451 aa Sequence Blast
gene length
1356 bp Sequence Blast
function
endopeptidase
product
penicillin-binding protein PBP 4* (spore cortex)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.7|Penicillin-binding proteins]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,534,118 → 3,535,473

    The protein

    Protein family

  • beta-lactamase family (according to Swiss-Prot)
  • Structure

  • [PDB|3TG9] (from ''Bacillus halodurans'', 27% identity, 59% similarity)
  • [SW|Localization]

  • spore cortex
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]-[gene|2ABCC493C6CA847A7BC65B1200A9B6490621462A|racX]
    description
    [Pubmed|8491712]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|8491712,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by cell wall stress ([protein|search|SigW]) [Pubmed|8491712,12207695]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE34440 (Δ[gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCCACCTCCCATAT, downstream forward: _UP4_ACGAAGTAGAAAGGAATGAA
  • BKK34440 (Δ[gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCCACCTCCCATAT, downstream forward: _UP4_ACGAAGTAGAAAGGAATGAA
  • GFP fusion

  • 3106 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]::pSG5046 (cat Pxyl-gfpa-[gene|FE672C27CF019E18A526DE8E6779788DDE54056E|pbpE]1-761) [pubmed|15758244], available in [SW|Dirk Jan Scheffers]' lab and in the [http://bgsc.org BGSC]
  • References

  • 8491712,12533473,9987136,19063962,12884008,12207695,7592498,20817675,15378759,15758244