SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


H+-coupled [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA]-[protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|MotB] flagellar stator
29.33 kDa
protein length
261 aa Sequence Blast
gene length
786 bp Sequence Blast
[category|SW 4.1.1|Motility and chemotaxis]
flagellar stator subunit

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,433,676 → 1,434,461

    Phenotypes of a mutant

  • increased [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P formation, resulting in reduced [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] expression and strongly reduced [SW|genetic competence] [pubmed|28800172]
  • loss of swimming and swarming motility [Pubmed|24296669]
  • mucoid phenotype due to the [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P activated overexpression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon and resulting overproduction of poly-gamma-glutamate [Pubmed|24296669,23888912]
  • The protein

    Protein family

  • MotB family (with [protein|6617D785D08C5919F0B774D2AF9EA6A84215486B|MotS], according to UniProt)
  • Paralogous protein(s)

  • [protein|6617D785D08C5919F0B774D2AF9EA6A84215486B|MotS]
  • [SW|Domains]

  • OmpA-like domain (aa 132-254)(according to UniPort)
  • a single trans-membrane helix [pubmed|29109979]
  • C-terminal extracytoplasmic peptidoglycan-binding domain [pubmed|29109979]
  • Modification

  • protonation of Asp-24 is essential for torque generation [Pubmed|23888912,9573160]
  • Structure

  • [PDB|4B62] (from Pseudomonas aeruginosa, corresponds to aa 110 ... 255, 33% identity)
  • [SW|Localization]

  • anchored to the cell wall, extending through the cell membrane [pubmed|29196522]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|6313226], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • available in [[Nicola Stanley-Wall]]'s lab [Pubmed|23888912]
  • BKE13680 (Δ[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCATGCTTCTTCTTCTTT, downstream forward: _UP4_TAGCAAAAAAGGAAGCCTTG
  • BKK13680 (Δ[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCATGCTTCTTCTTCTTT, downstream forward: _UP4_TAGCAAAAAAGGAAGCCTTG
  • References


  • 31136265
  • Original Publications

  • 6313226,24296669,23888912,9573160,25273986,28378843,29061663,28800172,29109979,16095621