SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


adenylylsulfate kinase
22.16 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
sulfate reduction and activation
adenylylsulfate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,169,877 → 1,170,476

    The protein

    Catalyzed reaction/ biological activity

  • adenosine 5'-phosphosulfate + ATP --> 3'-phosphoadenylyl sulfate + ADP + H+ (according to UniProt)
  • Protein family

  • APS kinase family (with [protein|3C71659E4868744A9301C26608EABF7B98217DCF|CysC], according to UniProt)
  • Structure

  • [PDB|3CR8] (from ''Escherichia coli'', 38% identity, 55% similarity) [Pubmed|19770499]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials


  • MGNA-A499 (yisZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10910 (Δ[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAATGATGTTCGGATTGT, downstream forward: _UP4_TAAAAAACCCGATCAATGTC
  • BKK10910 (Δ[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAATGATGTTCGGATTGT, downstream forward: _UP4_TAAAAAACCCGATCAATGTC
  • References

  • 15699190,15383836