SubtiBank SubtiBank
yisZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yisZ

adenylylsulfate kinase
locus
BSU10910
pI
7.21
mw
22.16 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
function
sulfate reduction and activation
product
adenylylsulfate kinase
essential
no
ec
2.7.1.25
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,169,877 → 1,170,476

    The protein

    Catalyzed reaction/ biological activity

  • ATP + adenylyl sulfate = ADP + 3'-phosphoadenylyl sulfate (according to Swiss-Prot)
  • Protein family

  • APS kinase family (according to Swiss-Prot)
  • Structure

  • [PDB|3CR8] (from ''Escherichia coli'', 38% identity, 55% similarity) [Pubmed|19770499]
  • Expression and Regulation

    Operons

    genes
    [gene|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]-[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]-[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A499 (yisZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/499 NBRP B. subtilis, Japan]
  • BKE10910 (Δ[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAATGATGTTCGGATTGT, downstream forward: _UP4_TAAAAAACCCGATCAATGTC
  • BKK10910 (Δ[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAATGATGTTCGGATTGT, downstream forward: _UP4_TAAAAAACCCGATCAATGTC
  • References

  • 15699190,15383836