SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


adenylylsulfate kinase
22.16 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
sulfate reduction and activation
adenylylsulfate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,169,877 → 1,170,476

    The protein

    Catalyzed reaction/ biological activity

  • adenosine 5'-phosphosulfate + ATP --> 3'-phosphoadenylyl sulfate + ADP + H+ (according to UniProt)
  • Protein family

  • APS kinase family (with [protein|3C71659E4868744A9301C26608EABF7B98217DCF|CysC], according to UniProt)
  • Structure

  • [PDB|3CR8] (from ''Escherichia coli'', 38% identity, 55% similarity) [Pubmed|19770499]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials


  • MGNA-A499 (yisZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10910 (Δ[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAATGATGTTCGGATTGT, downstream forward: _UP4_TAAAAAACCCGATCAATGTC
  • BKK10910 (Δ[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAATGATGTTCGGATTGT, downstream forward: _UP4_TAAAAAACCCGATCAATGTC
  • References

  • 15699190,15383836