SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor of [gene|search|citZ ]and [gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]
33.76 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
regulation of tricarboxylic acid branch of the TCA cycle
transcriptional repressor ([SW|LysR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    1,486,045 → 1,486,926

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • Structure

  • [PDB|5Z72] (from B. amyloliquefaciens, 96% identity)
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FE15A41A58A8177280817CA3825764C39185021A|CcpC]: repression, (molecular inducer: citrate) [Pubmed|11985717], in [regulon|FE15A41A58A8177280817CA3825764C39185021A|CcpC regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16395550], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed in the presence of glucose and glutamate ([protein|search|CcpC]) [Pubmed|11985717]
  • view in new tab


    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, by [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]~P [Pubmed|18840696,14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16395550,12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • MGNA-A774 (ykuM::erm), available at the [ NBRP B. subtilis, Japan]
  • GP206 (''aphA3'') & GP1442 (''aphA3'') , available in [SW|Jörg Stülke]'s lab
  • BKE14140 (Δ[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCCTCCTTTTTGT, downstream forward: _UP4_TAAAGACAGCGAGGTGCTGT
  • BKK14140 (Δ[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTCCTCCTTTTTGT, downstream forward: _UP4_TAAAGACAGCGAGGTGCTGT
  • GP2800 (''Δ''''[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]-[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP706, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP707 (in [SW|pAC5]), available in [SW|Stülke] lab, pGP711 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [ Homepage]
  • References

  • 17994626,23139400,11985717,10656796,12591885,14636591,16395550