SubtiBank SubtiBank
yhfP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhfP

putative quinone oxidoreductase, Zn-dependent and NAD(P)-binding
locus
BSU_10320
pI
4.72
mw
34.60 kDa
protein length
330 aa Sequence Blast
gene length
993 bp Sequence Blast
function
unknown
product
putative quinone oxidoreductase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,106,524 → 1,107,516

    The protein

    Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • [SW|Cofactors]

  • NADP+ (according to UniProt)
  • Structure

  • [PDB|1TT7] (99% identity)
  • [PDB|1Y9E] (with NAD), [PDB|1TT7]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|DCA3A7605CA19FAF61BDB75421BD41F11CB638E5|yhfO]-[gene|FE034FDCEAD4F4E91FD0147E16685632069E3316|yhfP]-[gene|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|FE034FDCEAD4F4E91FD0147E16685632069E3316|yhfP]-[gene|1469148C83B1704E721652203EA31F0E2C33FDC6|yhfQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A715 (yhfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/715 NBRP B. subtilis, Japan]
  • BKE10320 (Δ[gene|FE034FDCEAD4F4E91FD0147E16685632069E3316|yhfP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGCACACTCCTTTTC, downstream forward: _UP4_TAACAGGATCAGCTTGCAGA
  • BKK10320 (Δ[gene|FE034FDCEAD4F4E91FD0147E16685632069E3316|yhfP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGCACACTCCTTTTC, downstream forward: _UP4_TAACAGGATCAGCTTGCAGA