SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


prenylation of [protein|search|comX ]and surfactin expression ([gene|search|srfA])
34.05 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
regulation of quorum sensing

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,256,008 → 3,256,907

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • prenylation of [protein|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|ComX] on W-53 [Pubmed|22878193]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE31710 (Δ[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCTTGATCCGGA, downstream forward: _UP4_AGTTATACAAAGGGGGATAC
  • BKK31710 (Δ[gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCCTTGATCCGGA, downstream forward: _UP4_AGTTATACAAAGGGGGATAC
  • References


  • 28326143,30218468
  • Original publications

  • 12067344,25666134,19605685,22878193,11133937,1715859,19114482,24296669,24425772,24788106,25036949,25757097,26787913,29038467,31670609