SubtiBank SubtiBank
iolH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

iolH

unknown, may be involved in myo-inositol catabolism
locus
BSU_39690
pI
4.99
mw
33.37 kDa
protein length
289 aa Sequence Blast
gene length
870 bp Sequence Blast
function
unknown, may be involved in myo-inositol catabolism
product
unknown
essential
no
synonyms
yxdG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • Gene

    Coordinates
    4,074,896 → 4,075,765

    Expression and Regulation

    Operons

    genes
    [gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
    description
    [Pubmed|9226270]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B699 (iolH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1698 NBRP B. subtilis, Japan]
  • BKE39690 (Δ[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATATTTTCACTCCTCT, downstream forward: _UP4_TAAGCTGAGCATGGAGTTCG
  • BKK39690 (Δ[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATATTTTCACTCCTCT, downstream forward: _UP4_TAAGCTGAGCATGGAGTTCG
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,9887260,18310071