SubtiBank SubtiBank
iolH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

iolH

unknown, may be involved in myo-inositol catabolism
locus
BSU39690
pI
4.99
mw
33.37 kDa
protein length
289 aa Sequence Blast
gene length
870 bp Sequence Blast
function
unknown, may be involved in myo-inositol catabolism
product
unknown
essential
no
synonyms
yxdG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • Gene

    Coordinates
    4,074,896 → 4,075,765

    Expression and Regulation

    Operons

    genes
    [gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
    description
    [Pubmed|9226270]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B699 (iolH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1698 NBRP B. subtilis, Japan]
  • BKE39690 (Δ[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATATTTTCACTCCTCT, downstream forward: _UP4_TAAGCTGAGCATGGAGTTCG
  • BKK39690 (Δ[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATATTTTCACTCCTCT, downstream forward: _UP4_TAAGCTGAGCATGGAGTTCG
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,9887260,18310071