SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


negative regulator of transcription of the ribonucleotide reductase nrd operon
17.77 kDa
protein length
152 aa Sequence Blast
gene length
459 bp Sequence Blast
control of ribonucleotide reductase expression
transcription repressor of the ribonucleotide reductase nrd operon

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,965,681 → 2,966,139

    The protein

    Protein family

  • nrdR family (single member, according to UniProt)
  • Expression and Regulation




  • constitutively expressed [Pubmed|27920297]
  • additional information

  • the terminator is [protein|search|NusA]-dependent [ Reference]
  • view in new tab

    Biological materials


  • MGNA-A123 (ytcG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29000 (Δ[gene|FD4E988BB73F6476CCEA4C521F343D6F8CBA457F|nrdR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAAATCAGCTCCCAAC, downstream forward: _UP4_TAAAAGAGCTAAGAGGATTC
  • BKK29000 (Δ[gene|FD4E988BB73F6476CCEA4C521F343D6F8CBA457F|nrdR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAAAATCAGCTCCCAAC, downstream forward: _UP4_TAAAAGAGCTAAGAGGATTC
  • References

  • 16950922,9387221,15949864,27920297,28624879