SubtiBank SubtiBank
nrdEB

nrdEB

similar to ribonucleoside-diphosphate reductase (alpha subunit)
locus
BSU_20060
pI
6.39
mw
27.82 kDa
protein length
1168 aa Sequence Blast
gene length
3507 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yosN

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.5|Biosynthesis/ acquisition of nucleotides/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,162,108 → 2,165,614

    The protein

    Catalyzed reaction/ biological activity

  • [thioredoxin]-disulfide + 2'-deoxyribonucleoside 5'-diphosphate + H2O --> [thioredoxin]-dithiol + ribonucleoside 5'-diphosphate (according to UniProt)
  • Protein family

  • ribonucleoside diphosphate reductase large chain family (with [protein|3B68CE8E9A35997B45E437A316996D585E43B76B|NrdE], according to UniProt)
  • Paralogous protein(s)

  • [protein|3B68CE8E9A35997B45E437A316996D585E43B76B|NrdE]
  • [SW|Domains]

  • DOD-type homing endonuclease domain (aa 503-654) (according to UniProt)
  • Biological materials

    Mutant

  • BKE20060 (Δ[gene|FD4CD7DB35AA20DBBEC0A4DA5D88282D89CCDA6D|nrdEB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTGAGCTTGATCCAA, downstream forward: _UP4_TAATAGGTACGTTTACGTTT
  • BKK20060 (Δ[gene|FD4CD7DB35AA20DBBEC0A4DA5D88282D89CCDA6D|nrdEB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTGAGCTTGATCCAA, downstream forward: _UP4_TAATAGGTACGTTTACGTTT
  • References

  • 21498918,11470879,16621400,9465078