SubtiBank SubtiBank
nrdEB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nrdEB

similar to ribonucleoside-diphosphate reductase (alpha subunit)
locus
BSU20060
pI
6.39
mw
27.82 kDa
protein length
1168 aa Sequence Blast
gene length
3507 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yosN

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.5|Biosynthesis/ acquisition of nucleotides/ other]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,162,108 → 2,165,614

    The protein

    Paralogous protein(s)

  • [protein|3B68CE8E9A35997B45E437A316996D585E43B76B|NrdE]
  • Biological materials

    Mutant

  • BKE20060 (Δ[gene|FD4CD7DB35AA20DBBEC0A4DA5D88282D89CCDA6D|nrdEB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTGAGCTTGATCCAA, downstream forward: _UP4_TAATAGGTACGTTTACGTTT
  • BKK20060 (Δ[gene|FD4CD7DB35AA20DBBEC0A4DA5D88282D89CCDA6D|nrdEB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTGAGCTTGATCCAA, downstream forward: _UP4_TAATAGGTACGTTTACGTTT
  • References

  • 21498918,11470879,16621400,9465078