SubtiBank SubtiBank
gtcA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gtcA

teichoic acid glycosylation protein
locus
BSU38210
pI
8.50
mw
14.21 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
function
biosynthesis of teichoic acids
product
teichoic acid glycosylation protein
essential
no
synonyms
ywcD,ipa-34d,gtaC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.4|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.3|Biosynthesis of teichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,921,891 → 3,922,274

    The protein

    Protein family

  • GtrA family (with [protein|CBCBF948979D9D63CBA86A9ED865E43B1F85A0AD|YngA], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]-[gene|FD30C4E458E63E8D6A932B351D4224F1AACD4B1B|gtcA]-[gene|36930CC6FDFCA23D43E264FEA375B78A1434E1BD|galK]-[gene|591428EA1C3D40322BB942429607AF61A90BAF41|galT]
    description
    [Pubmed|22383849,22893383]

    regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B231 (ywcD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1230 NBRP B. subtilis, Japan]
  • BKE38210 (Δ[gene|FD30C4E458E63E8D6A932B351D4224F1AACD4B1B|gtcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTATTTCTCTATACT, downstream forward: _UP4_TGAGAGGACTGCAGCATATG
  • BKK38210 (Δ[gene|FD30C4E458E63E8D6A932B351D4224F1AACD4B1B|gtcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTATTTCTCTATACT, downstream forward: _UP4_TGAGAGGACTGCAGCATATG
  • References

  • 22383849,22893383