SubtiBank SubtiBank
bsdC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bsdC

phenolic acid decarboxylase
locus
BSU_03640
pI
5.12
mw
52.86 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
function
resistance to salicylic acid
product
phenolic acid decarboxylase
essential
no
synonyms
yclC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    413,157 → 414,578

    The protein

    Catalyzed reaction/ biological activity

  • conversion of vanillic acid to guaiacol [Pubmed|26658822]
  • 4-hydroxybenzoate + H+ --> CO2 + phenol (according to UniProt)
  • 4-hydroxy-3-methoxybenzoate + H+ --> CO2 + guaiacol (according to UniProt)
  • Protein family

  • ubiD family (single memberm, according to UniProt)
  • Structure

  • [PDB|5M1B] (from E. coli, 31% identity) [pubmed|28057757]
  • Expression and Regulation

    Operons

    genes
    [gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]-[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]-[gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD]
    description
    [Pubmed|17295427]

    regulatory mechanism

  • [protein|28D03575FA24525C162E6C161631034568E89622|BsdA]: activation, [Pubmed|17295427], in [regulon|28D03575FA24525C162E6C161631034568E89622|BsdA regulon]
  • regulation

  • induced by salicylic acid ([protein|search|BsdA]) [Pubmed|17295427]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C062 (yclC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2060 NBRP B. subtilis, Japan]
  • BKE03640 (Δ[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGAAATCTTGATAAGCCA, downstream forward: _UP4_AATAAATAAGGAAAGGATGT
  • BKK03640 (Δ[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGAAATCTTGATAAGCCA, downstream forward: _UP4_AATAAATAAGGAAAGGATGT
  • References

  • 15979273,17295427,26658822,28057757