SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcriptional regulator ([SW|ArsR family])
11.35 kDa
protein length
100 aa Sequence Blast
gene length
303 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    320,421 → 320,723

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 8-100) (according to UniProt)
  • Expression and Regulation


    (according to [ DBTBS]) null
    view in new tab

    Biological materials


  • MGNA-C114 (yceK::erm), available at the [ NBRP B. subtilis, Japan]
  • TMB150 (''yceK''::''spc''), available in [SW|Erhard Bremer]'s lab [Pubmed|23175650]
  • BKE02970 (Δ[gene|FCFC26903EAEAC7264D1DA035CB407B221F3E735|yceK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGGTGTTGAAAAAG, downstream forward: _UP4_TAACAAAGGGTTTTCTCTAT
  • BKK02970 (Δ[gene|FCFC26903EAEAC7264D1DA035CB407B221F3E735|yceK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGGGTGTTGAAAAAG, downstream forward: _UP4_TAACAAAGGGTTTTCTCTAT
  • References

  • 23175650,23504016